Contact

All Stories

  1. The Role of Folic Acid in DNA Methylation and Breast Cancer

    Article • International Journal for Vitamin and Nutrition Research, March 2025, IMR Press

    Dra en C Josefina Yoaly Sánchez López

  2. Metformin in combination with chemotherapy increases apoptosis in gastric cancer cells and counteracts senescence induced by chemotherapy

    Article • Oncology Letters, July 2024, Spandidos Publications

    Dra en C Josefina Yoaly Sánchez López

  3. Single nucleotide polymorphism rs4961 in the adducin 1 gene is not associated with gastric cancer or preneoplastic cancer lesions

    Article • Oncology Letters, July 2024, Spandidos Publications

    Dra en C Josefina Yoaly Sánchez López

  4. Pepsinogen I, pepsinogen II, gastrin-17, and Helicobacter pylori serological biomarkers in the diagnosis of precursor lesions of gastric cancer

    Article • Archives of Medical Science, June 2024, Termedia Sp. z.o.o.

    Dra en C Josefina Yoaly Sánchez López

  5. Medium and large alleles of the PGC gene are risk factors for gastric cancer

    Article • Tumor Biology, April 2023, IOS Press

    Dra en C Josefina Yoaly Sánchez López

  6. Low expression of E-Cadherin and <i>Cdh1</i> variants associated with diffuse gastric cancer

    Article • Revista de Investigación Clínica, February 2023, Publicidad Permanyer, SLU

    Dra en C Josefina Yoaly Sánchez López

  7. SOD2 Gene Variants (rs4880 and rs5746136) and Their Association with Breast Cancer Risk

    Article • Current Issues in Molecular Biology, October 2022, MDPI AG

    Dra en C Josefina Yoaly Sánchez López

  8. Role of the BMP6 protein in breast cancer and other types of cancer

    Article • Growth Factors, July 2021, Taylor & Francis

    Dra en C Josefina Yoaly Sánchez López

  9. Predicting Pathogenicity of CDH1 Gene Variants in Patients with Early-onset Diffuse Gastric Cancer from Western Mexico

    Article • Revista de Investigación Clínica, May 2021, Publicidad Permanyer, SLU

    Dra en C Josefina Yoaly Sánchez López

  10. Molecular and Hematological Analysis of Alpha- and Beta-Thalassemia in a Cohort of Mexican Patients

    Article • Genetic Testing and Molecular Biomarkers, March 2021, Mary Ann Liebert Inc

    Dra en C Josefina Yoaly Sánchez López

  11. The Relationship of Single Nucleotide Polymorphisms in the TRPV1 Gene with Lipid Profile, Glucose, and Blood Pressure in Mexican Population

    Article • Genetic Testing and Molecular Biomarkers, July 2020, Mary Ann Liebert Inc

    Dra en C Josefina Yoaly Sánchez López

  12. LDLR Gene Mutation p.Asp360His and Familial Hypercholesterolemia in a Mexican Community

    Article • Archives of Medical Research, February 2020, Elsevier

    Dra en C Josefina Yoaly Sánchez López

  13. CDH1 somatic alterations in Mexican patients with diffuse and mixed sporadic gastric cancer

    Article • BMC Cancer, January 2019, Springer Science + Business Media

    Dr Luis F Jave-Suarez, Dra en C Josefina Yoaly Sánchez López

  14. Association of polymorphisms of the TNFRSF11B and TNFSF11 genes with bone mineral density in postmenopausal women from western Mexico

    Article • Archives of Medical Science, January 2019, Termedia Sp. z.o.o.

    Dra en C Josefina Yoaly Sánchez López

  15. The ERBB2 gene polymorphisms rs2643194, rs2934971, and rs1058808 are associated with increased risk of gastric cancer

    Article • Brazilian Journal of Medical and Biological Research, January 2019, FapUNIFESP (SciELO)

    Dra en C Josefina Yoaly Sánchez López

  16. TYMS 2R3R polymorphism and DPYD [IVS]14+1G>A mutation genes in Mexican colorectal cancer patients

    Article • Acta Biochimica Polonica, July 2018, Polskie Towarzystwo Biochemiczne (Polish Biochemical Society)

    Dra en C Josefina Yoaly Sánchez López

  17. Screening of LDLR and APOB gene mutations in Mexican patients with homozygous familial hypercholesterolemia

    Article • Journal of Clinical Lipidology, May 2018, Elsevier

    Dra en C Josefina Yoaly Sánchez López

  18. Thymidylate synthase gene variants as predictors of clinical response and toxicity to fluoropyrimidine-based chemotherapy for colorectal cancer

    Article • Drug Metabolism and Personalized Therapy, December 2017, De Gruyter

    AUGUSTO ROJAS-MARTINEZ, Dra en C Josefina Yoaly Sánchez López

  19. Los receptores epidérmicos humanos en el cáncer gástrico: alteraciones moleculares y su papel como diana terapéutica

    Article • Gaceta Médica de México, December 2017, Publicidad Permanyer, SLU

    Dra en C Josefina Yoaly Sánchez López

  20. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients

    Article • International Journal of Laboratory Hematology, June 2017, Wiley

    Dra en C Josefina Yoaly Sánchez López

  21. A Novel 31.1 kb α-Thalassemia Deletion (– –MEX3) Found in a Mexican Family

    Article • Hemoglobin, May 2017, Taylor & Francis

    Dra en C Josefina Yoaly Sánchez López

  22. Molecular analysis of complex cases of alpha- and beta-thalassemia in Mexican mestizo patients with microcytosis and hypochromia reveals two novel alpha0-thalassemia deletions - -Mex1and - -Mex2

    Article • International Journal of Laboratory Hematology, June 2016, Wiley

    Dra en C Josefina Yoaly Sánchez López

  23. Association between the CDH1-472delA and -160C>A polymorphisms and diffuse and intestinal gastric cancer in a Mexican population

    Article • Genetics and Molecular Research, January 2016, Genetics and Molecular Research

    Dra en C Josefina Yoaly Sánchez López

  24. Epidermal growth factor receptor expression in gastric tumors and its relationship with the germline polymorphisms − 216 G>T, −191 C>A, (CA) n IVS1, and R521K

    Article • Indian Journal of Cancer, January 2016, Medknow

    Dra en C Josefina Yoaly Sánchez López

  25. 5′ and 3′ β-globin haplotypes in purepechas and Tarahumaras, two Mexican indigenous groups

    Article • American Journal of Human Biology, March 2015, Wiley

    Dra en C Josefina Yoaly Sánchez López

  26. EGFR gene polymorphisms -216G>T and -191C>A are risk markers for gastric cancer in Mexican population

    Article • Genetics and Molecular Research, January 2015, Genetics and Molecular Research

    Dra en C Josefina Yoaly Sánchez López

  27. Factores de riesgo para osteoporosis en mujeres posmenopáusicas de Guadalajara, Jalisco

    Article • Salud Pública de México, November 2013, Instituto Nacional de Salud Publica

    Dra en C Josefina Yoaly Sánchez López

  28. Association analysis of vitamin D receptor gene polymorphisms and bone mineral density in postmenopausal Mexican-Mestizo women

    Article • Genetics and Molecular Research, January 2013, Genetics and Molecular Research

    Dra en C Josefina Yoaly Sánchez López

  29. Characterization of the 5′ and 3′ Breakpoints of the Spanish (δβ)0-Thalassemia Deletion in Mexican Patients

    Article • Hemoglobin, January 2011, Taylor & Francis

    Dra en C Josefina Yoaly Sánchez López

  30. Analysis of the SLC4A1 gene in three Mexican patients with hereditary spherocytosis: report of a novel mutation

    Article • Genetics and Molecular Biology, December 2009, FapUNIFESP (SciELO)

    Dra en C Josefina Yoaly Sánchez López

  31. HB Fannin-Lubbock-I with A Single GGC>GAC Mutation at β119(GH2)Gly→Asp in a Homozygous Mexican Patient

    Article • Hemoglobin, December 2009, Taylor & Francis

    Dra en C Josefina Yoaly Sánchez López

  32. Molecular spectrum of β-thalassemia in the Mexican population

    Article • Blood Cells Molecules and Diseases, September 2004, Elsevier

    Dra en C Josefina Yoaly Sánchez López

  33. Red cell membrane protein deficiencies in Mexican patients with hereditary spherocytosis

    Article • Blood Cells Molecules and Diseases, November 2003, Elsevier

    Dra en C Josefina Yoaly Sánchez López

  34. Analysis of βS and βA Genes in a Mexican Population with African Roots

    Article • Blood Cells Molecules and Diseases, March 2002, Elsevier

    Dra en C Josefina Yoaly Sánchez López